Skip to main content
Addgene
Open Menu

pmCherry-N1-EXO1b
(Plasmid #111621)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111621 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 111621-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 111621-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pmCherry-N1
  • Modifications to backbone
    eGFP of peGFP-N1 plasmid was substituted with mCherry
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Exonuclease 1b
  • Alt name
    EXO1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2538
  • Entrez Gene
    EXO1 (a.k.a. HEX1, hExoI)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ACCAGAGTCGGGTACTGTTTCAGA
  • 3′ sequencing primer TAGTGTTCCCAAAGTGGGTGGTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pmCherry-N1-EXO1b presents K589, H354, E670, R723C polymorphisms, also normally expressed in different type of cells analyzed.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-N1-EXO1b was a gift from Marco Muzi-Falconi (Addgene plasmid # 111621 ; http://n2t.net/addgene:111621 ; RRID:Addgene_111621)

  • For your References section:

    Coordinated Activity of Y Family TLS Polymerases and EXO1 Protects Non-S Phase Cells from UV-Induced Cytotoxic Lesions. Sertic S, Mollica A, Campus I, Roma S, Tumini E, Aguilera A, Muzi-Falconi M. Mol Cell. 2018 Apr 5;70(1):34-47.e4. doi: 10.1016/j.molcel.2018.02.017. Epub 2018 Mar 15. 10.1016/j.molcel.2018.02.017 PubMed 29551515
Related items:
Commonly requested with: