pHES944
(Plasmid
#112642)
-
Purposeexpress SST2 from the GAL1 promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112642 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSV604
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 9300
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSST2
-
SpeciesS. cerevisiae (budding yeast)
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTAAGATACACATAGGGATAAAATGTG
- 3′ sequencing primer ATC GCA CTC ACG TAA ACA CTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHES944 was a gift from Hana El-Samad (Addgene plasmid # 112642 ; http://n2t.net/addgene:112642 ; RRID:Addgene_112642) -
For your References section:
Real-Time Genetic Compensation Defines the Dynamic Demands of Feedback Control. Harrigan P, Madhani HD, El-Samad H. Cell. 2018 Oct 18;175(3):877-886.e10. doi: 10.1016/j.cell.2018.09.044. 10.1016/j.cell.2018.09.044 PubMed 30340045