Skip to main content

pcDNA3.1/TO-myc-BirA*-cCE
(Plasmid #112713)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112713 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 112713-D50 50 μg of DNA in Tris buffer $495
DNA 112713-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1 mycBioID
  • Backbone manufacturer
    Addgene plasmid #35700
  • Backbone size w/o insert (bp) 6516
  • Total vector size (bp) 8363
  • Modifications to backbone
    Tet operator (TO) sequence added downstream of TATA box for Tet repressor binding at an analogous position as in pcDNA4/TO. NotI restriction site changed to a BsrGI restriction site downstream of insert.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rngtt
  • Alt name
    CE, mCE
  • Alt name
    Capping enzyme
  • Alt name
    RNA guanylyltransferase and 5'-phosphatase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1849
  • Mutation
    Silent mutation at Arg 132 (CGT to CGC), deleted amino acids 573-576 (KRKY nuclear localization signal)
  • Entrez Gene
    Rngtt (a.k.a. AU020997, HCE, MCE1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • myc tag (N terminal on backbone)
    • BirA* (BirA R118G) (N terminal on backbone)
    • HIV Rev nuclear localization signal (NES) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer BGH-R (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    BirA* sequence included in Addgene plasmid #35700 (credit to Kyle Roux). Source of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Tet operator sequence added to pcDNA3.1-myc-BirA*-cCE, originally described in Trotman et al. 2017 (10.1093/nar/gkx801)

Additional internal sequencing primers:
IntBirA1-F: CATTCGGAGCCAACCTGTACCTG
IntBirA2-F: CGACAAGGAAATCTTCGGCATCTCC
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/TO-myc-BirA*-cCE was a gift from Daniel Schoenberg (Addgene plasmid # 112713 ; http://n2t.net/addgene:112713 ; RRID:Addgene_112713)
  • For your References section:

    RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341