Skip to main content

pYFP-NGAT
(Plasmid #11383)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11383 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 11383-D50 50 μg of DNA in Tris buffer $495
DNA 11383-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEYFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    golgi associated, gamma adaptin ear containing, ARF binding protein 1
  • Alt name
    GGA1
  • Alt name
    NGAT
  • Alt name
    hook
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    141
  • GenBank ID
    NM_013365
  • Entrez Gene
    GGA1
  • Tag / Fusion Protein
    • YFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTGAGCAAAGACCCCAACGAGAA
  • 3′ sequencing primer CAGGGGGAGGTGTGGGAGGTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hGGA1 cDNA was a gift of Juan Bonifacino. The N-terminal end of the GAT domain, corresponding to amino acids 165-210 and termed NGAT, were amplified and inserted in pEYFP-C1.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Encodes a YFP fusion to the N-terminus of the GGA1 NGAT domain. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP variant.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYFP-NGAT was a gift from Joel Swanson (Addgene plasmid # 11383 ; http://n2t.net/addgene:11383 ; RRID:Addgene_11383)
  • For your References section:

    A Phosphatidylinositol-3-Kinase-Dependent Signal Transition Regulates ARF1 and ARF6 during Fcgamma Receptor-Mediated Phagocytosis. Beemiller P, Hoppe AD, Swanson JA. PLoS Biol. 2006 May 9. 4(6):e162. 10.1371/journal.pbio.0040162 PubMed 16669702