pET21a.AQ_1575
(Plasmid
#11416)
-
Depositing Lab
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in United States of America -
Sequence Information
-
Please contact us if you would like Addgene to sequence a portion of this plasmid before you request it.
-
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET21a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5443
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehypothetical
-
SpeciesA. aeolicus
-
Insert Size (bp)747
-
GenBank IDAAC07491 AQ_1575 NP_214082
-
Entrez Geneaq_1575
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pET21a.AQ_1575 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21a.AQ_1575 was a gift from Sung-Hou Kim (Addgene plasmid # 11416 ; http://n2t.net/addgene:11416 ; RRID:Addgene_11416) -
For your References section:
Crystal structure of conserved hypothetical protein Aq1575 from Aquifex aeolicus. Shin DH, Yokota H, Kim R, Kim SH. Proc Natl Acad Sci U S A. 2002 Jun 11. 99(12):7980-5. 10.1073/pnas.132241399 PubMed 12060744