Skip to main content

pSKB3.MPN625
(Plasmid #11430)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11430 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSKB3
  • Backbone size w/o insert (bp) 5386
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    peroxiredoxin
  • Alt name
    stress inducible protein
  • Species
    M. pneumoniae
  • Insert Size (bp)
    423
  • GenBank ID
    AAB95865 NP_110314 MPN625
  • Entrez Gene
    MPN625 (a.k.a. C12_orf141)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pSKB3.MPN625 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSKB3.MPN625 was a gift from Sung-Hou Kim (Addgene plasmid # 11430 ; http://n2t.net/addgene:11430 ; RRID:Addgene_11430)
  • For your References section:

    Crystal structure of a stress inducible protein from Mycoplasma pneumoniae at 2.85 A resolution. Choi IG, Shin DH, Brandsen J, Jancarik J, Busso D, Yokota H, Kim R, Kim SH. J Struct Funct Genomics. 2003 . 4(1):31-4. 10.1023/A:1024625122089 PubMed 12943365