ZmMATE2
(Plasmid
#117094)
-
Purposeprotein expression in yeast
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepPICZc
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZmMATE2
-
Alt nametr|C0PJP2|C0PJP2_MAIZE MATE efflux family protein OS=Zea mays GN=LOC100383875 PE=2 SV=1
- Promoter AOX
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTGGTTCCAATTGACAAGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ZmMATE2 was a gift from Geoffrey Chang (Addgene plasmid # 117094 ; http://n2t.net/addgene:117094 ; RRID:Addgene_117094)