pSMPUW-miR-124-GFP-Puro
(Plasmid
#117321)
-
PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intron
-
Depositing Lab
-
Depositing OrganizationTechnische Universitaet Dresden
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSMPUW-miR-GFP-Puro
-
Backbone manufacturerCell Biolabs
- Backbone size w/o insert (bp) 6890
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehsa-miR-124-1
-
Alt nameNR_029668
-
Alt nameENST00000385275.1
-
gRNA/shRNA sequenceaggcctctctctccgtgttcacagcggaccttgatttaaatgtccatacaattaaggcacgcggtgaatgccaagaatggggctg
-
SpeciesH. sapiens (human)
-
Insert Size (bp)719
-
Entrez GeneMIR124-1 (a.k.a. MIR124A, MIR124A1, MIRN124-1, MIRN124A1, mir-124-1)
- Promoter EF1a
-
Tag
/ Fusion Protein
- GFP-Puro (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGCATTTGTAATTTTAAAAA
- 3′ sequencing primer GTGGGAGGAAGATAAGAGGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' PshAI cloning site destroyed
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMPUW-miR-124-GFP-Puro was a gift from Volker Busskamp (Addgene plasmid # 117321 ; http://n2t.net/addgene:117321 ; RRID:Addgene_117321) -
For your References section:
Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704