pCarCBADE_ProB(I69E)A
(Plasmid
#117756)
-
PurposeProB(I69E)A and codon optimized CarCBADE enzymes (in that order) in pBbaA5k backbone
-
Depositing Lab
-
Depositing OrganizationDelft University of Technology
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBbaA5k
-
Backbone manufacturerGenebank
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGlutamate kinase (ProA), mutant pyrroline-5-carboxylate synthase (ProBI69E) from E. coli and codon optimised CarCBADE operon
-
Alt nameProA
-
Alt nameProBI69E
-
Alt nameCarCBADE
-
SpeciesPectobacterium carotovorum
-
Insert Size (bp)7011
-
GenBank ID
- Promoter PLac(UV5)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTATAATGTGTGGAATTGTGAGC
- 3′ sequencing primer AACGCCCTAGGTATAAACGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCarCBADE_ProB(I69E)A was a gift from Greg Bokinsky (Addgene plasmid # 117756 ; http://n2t.net/addgene:117756 ; RRID:Addgene_117756) -
For your References section:
Metabolic engineering of a carbapenem antibiotic synthesis pathway in Escherichia coli. Shomar H, Gontier S, van den Broek NJF, Tejeda Mora H, Noga MJ, Hagedoorn PL, Bokinsky G. Nat Chem Biol. 2018 Aug;14(8):794-800. doi: 10.1038/s41589-018-0084-6. Epub 2018 Jun 25. 10.1038/s41589-018-0084-6 PubMed 29942079