Skip to main content

pLenti-EB1-EGFP
(Plasmid #118084)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118084 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEF1α-IRES-EGFP
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human EB1
  • Species
    H. sapiens (human)
  • Entrez Gene
    MAPRE1 (a.k.a. EB1)
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please refer to pLenti-IFT20-EGFP for cloning info.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EB1-EGFP was a gift from Ken-Ichi Takemaru (Addgene plasmid # 118084 ; http://n2t.net/addgene:118084 ; RRID:Addgene_118084)