pDM_noro_S6_lacZA
(Plasmid
#118817)
-
PurposeT7 RNAP-driven expression of norovirus sense orientation toehold switches (S6) with a lacZ alpha subunit reporter.
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCOLAduet
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNorovirus toehold switch S6
-
SpeciesSynthetic
-
Insert Size (bp)347
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTTACTGGTTTCACATTCACCACCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Output gene is lacZa
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDM_noro_S6_lacZA was a gift from Alexander Green (Addgene plasmid # 118817 ; http://n2t.net/addgene:118817 ; RRID:Addgene_118817) -
For your References section:
Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment. Ma D, Shen L, Wu K, Diehnelt CW, Green AA. Synth Biol (Oxf). 2018;3(1):ysy018. doi: 10.1093/synbio/ysy018. Epub 2018 Sep 19. 10.1093/synbio/ysy018 PubMed 30370338