FB009
(Plasmid
#119707)
-
PurposeTranscriptional Unit (TU) for geneticin (G418) resistance in fungi obtained by combining FB001+FB005+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMT
-
Depositing Lab
-
Depositing OrganizationAgencia Estatal Consejo Superior de Investigaciones Científicas, M.P.
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePDGB3alpha2 (Addgene #68214)
-
Backbone manufacturerDiego Orzaez
- Backbone size w/o insert (bp) 6967
- Total vector size (bp) 7810
-
Vector typeSynthetic Biology
-
Selectable markersGeneticin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePtrpC::nptII::Ttub
-
SpeciesAspergillus nidulans (PtrpC), Escherichia coli (nptII), Neurospora crassa (Ttub)
-
Insert Size (bp)1142
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsa1 (destroyed during cloning)
- 3′ cloning site Bsa1 (destroyed during cloning)
- 5′ sequencing primer CGAGTGGTGATTTTGTGCCG
- 3′ sequencing primer CCCGCCAATATATCCTGTCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FB009 was a gift from Jose Marcos (Addgene plasmid # 119707 ; http://n2t.net/addgene:119707 ; RRID:Addgene_119707) -
For your References section:
FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684