Skip to main content

FB026
(Plasmid #119711)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119711 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    PDGB3alpha1R
  • Backbone manufacturer
    Diego Orzaez
  • Backbone size w/o insert (bp) 6969
  • Total vector size (bp) 8089
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Promoter gpdA:YFP coding sequence:Terminator trpC
  • Alt name
    FB007+GB0053+FB008
  • Species
    Aspergillus nidulans (Pgpda), A. victoria (yfp), Aspergillus nidulans (TtrpC)
  • Insert Size (bp)
    1710

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bsa1 (destroyed during cloning)
  • 3′ cloning site Bsa1 (destroyed during cloning)
  • 5′ sequencing primer CGAGTGGTGATTTTGTGCCG
  • 3′ sequencing primer CCCGCCAATATATCCTGTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FB026 was a gift from Jose Marcos (Addgene plasmid # 119711 ; http://n2t.net/addgene:119711 ; RRID:Addgene_119711)
  • For your References section:

    FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684