pAM-CAG-GFP-TTC-DIO
(Plasmid #119726)

• Purpose: Double-floxed version of TTC (Tetanus-Toxin C-Fragment) coupled to GFP for production of rAAVs and subsequent expression in mammalian cells
• Depositing Lab: Thomas Kuner
• Depositing Organization: Universitaetsklinikum Heidelberg
  Located in Germany
• Publication: retroLEAP: rAAV-based retrograde trans-synaptic labeling, expression and perturbation (unpublished)

Backbone

• Vector backbone: pAM-CAG-MCS-DIO
• Backbone size w/o insert (bp): 5694
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: MDS42recA cells are also recommended for growth.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-TTC
• Alt name: GFP-TetToxHc
• Species: Synthetic
• Insert Size (bp): 2148
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: agcggctcggggctgt
• 3′ sequencing primer: catagcgtaaaaggagcaaca

Resource Information

• A portion of this plasmid was derived from a plasmid made by: TTC (Tetanus-Toxin C-Fragment) was a kind gift from Thomas Binz while the GFP-sequence was a kind gift from Thomas Klugmann.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Small deletion in one of the ITRs does not affect plasmid function. Lab has successfully used these plasmids for virus production and subsequent viral injection.