pAG176 SLC23A2 3'UTR mut
(Plasmid
#12034)
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 12034-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 12034-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIS2
-
Backbone manufacturerpIS2 derived from pRL-SV40 (Promega)
- Backbone size w/o insert (bp) 3700
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN9 3'UTR mut
-
Alt nameSLC23A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)780
-
MutationMutations in microRNA recognition sites (seed matches): 1915-1920 and 2346-2351.
-
GenBank IDNM_005116
-
Entrez GeneSLC23A2 (a.k.a. RP1-237C24.1, NBTL1, SLC23A1, SVCT2, YSPL2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SLC23A2 3'UTR mutant in renilla luciferase reporter plasmid.
DNA (Catalog # 12034-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 12034-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG176 SLC23A2 3'UTR mut was a gift from David Bartel (Addgene plasmid # 12034 ; http://n2t.net/addgene:12034 ; RRID:Addgene_12034) -
For your References section:
The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420