Skip to main content

pAG151 SRPK2 3'UTR
(Plasmid #12040)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12040 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pIS2
  • Backbone manufacturer
    pIS2 derived from pRL-SV40 (Promega)
  • Backbone size w/o insert (bp) 3700
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N16 3'UTR
  • Alt name
    SRPK2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    775
  • GenBank ID
    NM_182691
  • Entrez Gene
    SRPK2 (a.k.a. SFRSK2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SRPK2 3'UTR in renilla luciferase reporter plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG151 SRPK2 3'UTR was a gift from David Bartel (Addgene plasmid # 12040 ; http://n2t.net/addgene:12040 ; RRID:Addgene_12040)
  • For your References section:

    The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420