Skip to main content

gamma2 UTR shRNA (shRNA4)
(Plasmid #120796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120796 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    mU6pro
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GABRG2 shRNA
  • gRNA/shRNA sequence
    GTGAGATTCAGCGAATAAGACCCCT
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Gabrg2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was originally cloned in Angel de Blas's lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

It targets gamma2 GABAA receptor subunit mRNA, nucleotides 1467–1491 located in the 3'-UTR of GenBank accesion number L08497. It targets both gamma2S and gamma2L mRNAs.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gamma2 UTR shRNA (shRNA4) was a gift from Angel de Blas (Addgene plasmid # 120796 ; http://n2t.net/addgene:120796 ; RRID:Addgene_120796)
  • For your References section:

    Disruption of postsynaptic GABA receptor clusters leads to decreased GABAergic innervation of pyramidal neurons. Li RW, Yu W, Christie S, Miralles CP, Bai J, Loturco JJ, De Blas AL. J Neurochem. 2005 Nov;95(3):756-70. doi: 10.1111/j.1471-4159.2005.03426.x. 10.1111/j.1471-4159.2005.03426.x PubMed 16248887