pAAV-EF1α1.1-ChrimsonR-tdTomato
(Plasmid
#122064)
-
PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α promoter (1.1kb short version).tdTomato has codons varied to reduce recombination. Using SV40 pA signal.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122064 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV-EF1α1.1
-
Backbone manufacturerScott Sternson lab
- Backbone size w/o insert (bp) 4974
- Total vector size (bp) 2496
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChrimsonR-tdTomato
-
Alt nameChrimson K176R mutant- tdTomato
-
Alt nameChR88m19-tdTomato
-
Alt nameChlamydomonas noctigama channelrhodopsin K176R mutant-tdTomato
-
SpeciesSynthetic; Chlamydomonas noctigama
-
Insert Size (bp)2496
-
MutationChrimson K176R mutant
-
GenBank IDKF992060
- Promoter EF1a(1.1kb short version)
-
Tag
/ Fusion Protein
- tdTomato (codon diversified version) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ggatcttggttcattctcaag
- 3′ sequencing primer aaagagacagcaaccagg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct was tested in vitro.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α1.1-ChrimsonR-tdTomato was a gift from Edward Boyden (Addgene plasmid # 122064 ; http://n2t.net/addgene:122064 ; RRID:Addgene_122064) -
For your References section:
Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633