-
Purposeexpression of PYL1-SfGFP-Coilin, lentivirus vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGFP fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCoilin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1731
-
Entrez GeneCOIL (a.k.a. CLN80, p80-coilin)
- Promoter PGK
-
Tag
/ Fusion Protein
- PYL1-SFGFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-PGK-PYL1-sfGFP-Coilin was a gift from Stanley Qi (Addgene plasmid # 122177 ; http://n2t.net/addgene:122177 ; RRID:Addgene_122177) -
For your References section:
CRISPR-Mediated Programmable 3D Genome Positioning and Nuclear Organization. Wang H, Xu X, Nguyen CM, Liu Y, Gao Y, Lin X, Daley T, Kipniss NH, La Russa M, Qi LS. Cell. 2018 Nov 15;175(5):1405-1417.e14. doi: 10.1016/j.cell.2018.09.013. Epub 2018 Oct 11. 10.1016/j.cell.2018.09.013 PubMed 30318144