Skip to main content

pLenti/TO/EYFP-P2A-IDH1(HA)
(Plasmid #122482)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122482 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti/TO/DEST
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 7725
  • Total vector size (bp) 9375
  • Modifications to backbone
    The V5 tag was replaced by a 3xFLAG sequence
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    isocitrate dehydrogenase 1
  • Alt name
    EYFP-IDH1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2163
  • Entrez Gene
    IDH1 (a.k.a. HEL-216, HEL-S-26, IDCD, IDH, IDP, IDPC, PICD)
  • Promoter CMV/TO
  • Tags / Fusion Proteins
    • P2A
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTGTACGGTGGGAGGTCTATATAA
  • 3′ sequencing primer CAGAGGTTGATTGTCGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti/TO/EYFP-P2A-IDH1(HA) was a gift from Eric Huang (Addgene plasmid # 122482 ; http://n2t.net/addgene:122482 ; RRID:Addgene_122482)
  • For your References section:

    Functional requirement of a wild-type allele for mutant IDH1 to suppress anchorage-independent growth through redox homeostasis. Tiburcio PDB, Xiao B, Berg S, Asper S, Lyne S, Zhang Y, Zhu X, Yan H, Huang LE. Acta Neuropathol. 2018 Feb;135(2):285-298. doi: 10.1007/s00401-017-1800-0. Epub 2017 Dec 29. 10.1007/s00401-017-1800-0 [pii] PubMed 29288440