pKS_3MYC_PAC
(Plasmid
#122566)
-
Purpose(Empty Backbone) Vector for endogenously tagging Giardia genes with a triple Myc tag (Puromycin selection)
-
Depositing Labs
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonebluescript
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- 3x c-Myc tag (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer CAGTCACGACGTTGTAAAACGA
- 3′ sequencing primer CATCGTATGGGTACTCCGCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byStephane Gourguechon generated the plasmid in Zac Cande's lab (retired).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKS_3MYC_PAC was a gift from Zacheus Cande & Alexander Paredez (Addgene plasmid # 122566 ; http://n2t.net/addgene:122566 ; RRID:Addgene_122566) -
For your References section:
Rapid tagging and integration of genes in Giardia intestinalis. Gourguechon S, Cande WZ. Eukaryot Cell. 2011 Jan;10(1):142-5. doi: 10.1128/EC.00190-10. Epub 2010 Nov 29. 10.1128/EC.00190-10 PubMed 21115739