-
PurposeMAGIC donor plasmid (pBBR1 oriR with beta-lactamase/sfGFP payload)
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122579 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJN105
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6232
-
Modifications to backbonegent resistance replaced with beta-lactamase
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)898
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTATGCTACTCCGTCAAGCC
- 3′ sequencing primer CGCTTACAATTTCCATTCGCCATTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See supplemental tables of the referenced paper for more information on each plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGT-B1 was a gift from Harris Wang (Addgene plasmid # 122579 ; http://n2t.net/addgene:122579 ; RRID:Addgene_122579) -
For your References section:
Metagenomic engineering of the mammalian gut microbiome in situ. Ronda C, Chen SP, Cabral V, Yaung SJ, Wang HH. Nat Methods. 2019 Feb;16(2):167-170. doi: 10.1038/s41592-018-0301-y. Epub 2019 Jan 14. 10.1038/s41592-018-0301-y PubMed 30643213