Skip to main content

pHybr_r2a>m2a(silent)-srt-his
(Plasmid #124807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124807 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 124807-D50 50 μg of DNA in Tris buffer $495
DNA 124807-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pHybr_r2a
  • Backbone size w/o insert (bp) 4706
  • Total vector size (bp) 5797
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR ; HDR template
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Murine IgG2a (Fc silent)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1091
  • Mutation
    L234A/L235A/N297A
  • Tags / Fusion Proteins
    • Sortag (LPETGG) (C terminal on insert)
    • Histag (HHHHHH) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTAAAACGACGGCCAGT
  • 3′ sequencing primer CACATTGCCAAAAGACGGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHybr_r2a>m2a(silent)-srt-his was a gift from Ferenc Scheeren & Martijn Verdoes (Addgene plasmid # 124807 ; http://n2t.net/addgene:124807 ; RRID:Addgene_124807)
  • For your References section:

    Functional diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. van der Schoot JMS, Fennemann FL, Valente M, Dolen Y, Hagemans IM, Becker AMD, Le Gall CM, van Dalen D, Cevirgel A, van Bruggen JAC, Engelfriet M, Caval T, Bentlage AEH, Fransen MF, Nederend M, Leusen JHW, Heck AJR, Vidarsson G, Figdor CG, Verdoes M, Scheeren FA. Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug. 10.1126/sciadv.aaw1822 PubMed 31489367