Skip to main content

PX459-gR2A_Hinge
(Plasmid #124811)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124811 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    PX459
  • Backbone size w/o insert (bp) 9174
  • Total vector size (bp) 9289
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    Puromycin ; R166H in PuroR (please see depositors comment below)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9 – gRNA_R2A_hinge
  • Alt name
    PX459-gR2A_hinge
  • Species
    Synthetic
  • Mutation
    R166H in PuroR (please see depositors comment below)
  • Promoter pUC
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The gRNA is inserted in the PX459 backbone (#48139). The Puro gene in this plasmid has a point mutation that renders it less effective.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459-gR2A_Hinge was a gift from Ferenc Scheeren & Martijn Verdoes (Addgene plasmid # 124811 ; http://n2t.net/addgene:124811 ; RRID:Addgene_124811)
  • For your References section:

    Functional diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. van der Schoot JMS, Fennemann FL, Valente M, Dolen Y, Hagemans IM, Becker AMD, Le Gall CM, van Dalen D, Cevirgel A, van Bruggen JAC, Engelfriet M, Caval T, Bentlage AEH, Fransen MF, Nederend M, Leusen JHW, Heck AJR, Vidarsson G, Figdor CG, Verdoes M, Scheeren FA. Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug. 10.1126/sciadv.aaw1822 PubMed 31489367