PX459-gR2A_Hinge
(Plasmid #124811)

• Purpose: Vector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.
• Depositing Labs: Ferenc Scheeren, Martijn Verdoes
• Publication: van der Schoot et al Sci Adv. 2019 Aug 28;5(8):eaaw1822. doi: 10.1126/sciadv.aaw1822. eCollection 2019 Aug.

Backbone

• Vector backbone: PX459
• Backbone size w/o insert (bp): 9174
• Total vector size (bp): 9289
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR
• Selectable markers: Puromycin ; R166H in PuroR (please see depositors comment below)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9 – gRNA_R2A_hinge
• Alt name: PX459-gR2A_hinge
• Species: Synthetic
• Mutation: R166H in PuroR (please see depositors comment below)
• Promoter: pUC
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on insert)
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATT
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The gRNA is inserted in the PX459 backbone (#48139). The Puro gene in this plasmid has a point mutation that renders it less effective.