-
PurposeGlobal labeling of inhibitory synapses (red fluorescence)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 4589
- Total vector size (bp) 6978
-
Modifications to backboneInserted IL2RGTC DNA binding sequence upstream of promoter. Changed to EF1A promoter.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRuby2-Gephyrin.FingR-IL2RGTC
-
Insert Size (bp)1590
- Promoter EF1A
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCAGTCAATCTTTCACAAAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPart of this gene was derived from Addgene plasmids 46296 and 40260 deposited by Don Arnold and Michael Lin.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-mRuby2-Gephyrin.FingR-IL2RGTC was a gift from Xue Han (Addgene plasmid # 125696 ; http://n2t.net/addgene:125696 ; RRID:Addgene_125696) -
For your References section:
A Viral Toolbox of Genetically Encoded Fluorescent Synaptic Tags. Bensussen S, Shankar S, Ching KH, Zemel D, Ta TL, Mount RA, Shroff SN, Gritton HJ, Fabris P, Vanbenschoten H, Beck C, Man HY, Han X. iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330. 10.1016/j.isci.2020.101330 PubMed 32674057