HypaR-SpCas9
(Plasmid
#126757)
-
PurposeExpression plasmid for human codon-optimized increased fidelity Hypa2SpCas9 (without U6-sgRNA coding sequence, with silent mutations)
-
Depositing Lab
-
Depositing OrganizationHUN-REN Research Centre for Natural Sciences
Located in Hungary -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330-like (without U6-sgRNA coding sequence)
- Total vector size (bp) 8077
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHypa2SpCas9
-
Alt namemodified HypaSpCas9 (containing an extra mutation: R661A)
-
SpeciesS. pyogenes
-
Insert Size (bp)4272
-
MutationR661A, N692A, M694A, Q695A, H698A
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAGGGATGGTTGGTTGGTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCbh-3xFLAG-NLS-Hypa2SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations).
The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).
For detailed information and plasmid usage, please see the associated publication. Please visit https://doi.org/10.1101/2022.08.16.504097 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HypaR-SpCas9 was a gift from Ervin Welker (Addgene plasmid # 126757 ; http://n2t.net/addgene:126757 ; RRID:Addgene_126757) -
For your References section:
A cleavage rule for selection of increased-fidelity SpCas9 variants with high efficiency and no detectable off-targets. Kulcsar PI, Talas A, Ligeti Z, Toth E, Rakvacs Z, Bartos Z, Krausz SL, Welker A, Vegi VL, Huszar K, Welker E. Nat Commun. 2023 Sep 16;14(1):5746. doi: 10.1038/s41467-023-41393-5. 10.1038/s41467-023-41393-5 PubMed 37717069