-
PurposePiggybac transposon plasmid for expression of CMV promoter firefly luciferase (FLuc) and SV40 destabilized green fluorescent protein (GFPd2)
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 127190-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 127190-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePB-CAG-GAPd2
- Backbone size w/o insert (bp) 6466
- Total vector size (bp) 8174
-
Modifications to backboneInsertion of CMV-FLuc-bGH - SV40_prom to replace original CAG promoter of PB-GFPd2. Yields expression of firefly luciferase and destabilized GFPd2 driven by separate promoters.
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameFLuc
-
Insert Size (bp)1689
-
GenBank IDAAA89082
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer CTGGTCGAGCTGGACGGCGACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 127190-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 127190-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-FLuc+GFPd2 was a gift from Jordan Green (Addgene plasmid # 127190 ; http://n2t.net/addgene:127190 ; RRID:Addgene_127190)