Skip to main content

pR26
(Plasmid #127372)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127372 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCR-Blunt II-TOPO
  • Backbone manufacturer
    Invitrogen (Life Technologies)
  • Backbone size (bp) 9987
  • Modifications to backbone
    Inserted left and right ROSA26 homology arms, adenoviral splice acceptor, MCS, and DNA sequence encoding machinery facilitating doxycycline inducible gene expression (tight TRE promoter, rtTA-advanced), as well as PuroR resistance gene for stable selection.
  • Vector type
    Mouse Targeting, CRISPR
  • Promoter tight TRE promoter
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGTATGTCGAGGTAGGCG
  • 3′ sequencing primer GAGAGTGAAGCAGAACGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR26 was a gift from Lance Miller (Addgene plasmid # 127372 ; http://n2t.net/addgene:127372 ; RRID:Addgene_127372)
  • For your References section:

    Transcriptomic Features of T Cell-Barren Tumors Are Conserved Across Diverse Tumor Types. Routh ED, Pullikuth AK, Jin G, Chifman J, Chou JW, D'Agostino RB Jr, Seino KI, Wada H, Print CG, Zhang W, Lu Y, Miller LD. Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020. 10.3389/fimmu.2020.00057 PubMed 32117236