pcDNA3.1/NDUFS2 _34-78/myc-His
(Plasmid
#127496)
-
PurposeExpresses myc-tagged _34-78 NDUFS2 in mammalian cells
-
Depositing Labs
-
Depositing OrganizationSanford Burnham Prebys Medical Discovery Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 127496-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 127496-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1/myc-His(-)A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5500
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNDUFS2 _34-78
-
Alt nameNADH:ubiquinone oxidoreductase core subunit S2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1257
-
MutationNDUFS2 _34-78
-
Entrez GeneNDUFS2 (a.k.a. CI-49, MC1DN6)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer tgtgatcctcacatcgggctcctgcacc
- 3′ sequencing primer acctctgctgggctgaatcggcaatcgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 127496-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 127496-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/NDUFS2 _34-78/myc-His was a gift from Shashi Jain & Dieter Wolf (Addgene plasmid # 127496 ; http://n2t.net/addgene:127496 ; RRID:Addgene_127496) -
For your References section:
Metabolic targeting of cancer by a ubiquinone uncompetitive inhibitor of mitochondrial complex I. Jain S, Hu C, Kluza J, Ke W, Tian G, Giurgiu M, Bleilevens A, Campos AR, Charbono A, Stickeler E, Maurer J, Holinski-Feder E, Vaisburg A, Bureik M, Luo G, Marchetti P, Cheng Y, Wolf DA. Cell Chem Biol. 2021 Nov 23. pii: S2451-9456(21)00479-7. doi: 10.1016/j.chembiol.2021.11.002. 10.1016/j.chembiol.2021.11.002 PubMed 34852219