pTRIPZ shSTING-Mmu
(Plasmid
#127697)
-
PurposeDoxycyclin inducible shRNA knockdown of mouse STING gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTRIPZ RFP+
- Backbone size w/o insert (bp) 13320
- Total vector size (bp) 13412
-
Modifications to backboneinsertion of mouse STING specific shRNA hairpin sequence between XhoI and Eco RI restriction sites
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshSTING Mmu
-
Alt nameTmem173, 2610307O08Rik, ERIS, MPYS, Mita
-
gRNA/shRNA sequenceCTCGAAATAACTGCCGCCTCAT
-
SpeciesM. musculus (mouse)
-
GenBank ID72512
-
Entrez GeneSting1 (a.k.a. 2610307O08Rik, ERIS, MPYS, Mita, STING, STING-beta, Tmem173)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site xhoI (unknown if destroyed)
- 3′ cloning site ecoRI (unknown if destroyed)
- 5′ sequencing primer cagaaggctcgagaaggtatattgctgttgctgttgacagtgagcg
- 3′ sequencing primer ctaaagtagccccttgaattccgaggcagtaggca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ shSTING-Mmu was a gift from Sandra Demaria (Addgene plasmid # 127697 ; http://n2t.net/addgene:127697 ; RRID:Addgene_127697) -
For your References section:
DNA exonuclease Trex1 regulates radiotherapy-induced tumour immunogenicity. Vanpouille-Box C, Alard A, Aryankalayil MJ, Sarfraz Y, Diamond JM, Schneider RJ, Inghirami G, Coleman CN, Formenti SC, Demaria S. Nat Commun. 2017 Jun 9;8:15618. doi: 10.1038/ncomms15618. 10.1038/ncomms15618 PubMed 28598415