pDSM-f3
(Plasmid
#127722)
-
Purpose(Empty Backbone) Level 1 destination vector for a transcription unit, pathway position 7. Clone a transcription unit in with BsaI.
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDSM
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer GAAACCTTCGAATCCAGCCAGC
- 3′ sequencing primer ACTTAGTATGGTCTGTTGGAAAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Assembles a transcription unit and adds pathway position 7 homology arms, compatible with 5' position 3 and 3' ChrXV homology arm (3int). Ccdb selection is used to select for correct clones. Sequencing primers are also the primers for amplifying DNA for integration into the S. cerevisiae genome.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDSM-f3 was a gift from Christopher Voigt (Addgene plasmid # 127722 ; http://n2t.net/addgene:127722 ; RRID:Addgene_127722) -
For your References section:
Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070