Skip to main content

pDSM-de-Phhf2-PYC-Tadh1
(Plasmid #127737)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127737 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDSM-de
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pyruvate carboxylase
  • Alt name
    PYC
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    3559
  • GenBank ID
    MH366513
  • Entrez Gene
    PYC1 (a.k.a. YGL062W)
  • Promoter Phhf2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer AACGTTGTCCAGGTTTGTATCC
  • 3′ sequencing primer AGGTACAACAAGCACGACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PYC transcription unit with pathway position 5 homology arms, compatible with 5' position 4 and 3' position 6 homology arm. Sequencing primers are also the primers for amplifying DNA for integration into the S. cerevisiae genome.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDSM-de-Phhf2-PYC-Tadh1 was a gift from Christopher Voigt (Addgene plasmid # 127737 ; http://n2t.net/addgene:127737 ; RRID:Addgene_127737)
  • For your References section:

    Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070