pCMV-GABARα6N-HA
(Plasmid
#128111)
-
PurposeExpress HA tagged GABARα6 N terminal domain
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3718
- Total vector size (bp) 4675
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGabra6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)694
-
GenBank IDNM_001099641.2
-
Entrez GeneGabra6 (a.k.a. GABA-ARalpha6, Gabr, Gabra-6, al, alpha6)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GTTTTCTTCCGCCAGACTTGGACTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-GABARα6N-HA was a gift from Huda Zoghbi (Addgene plasmid # 128111 ; http://n2t.net/addgene:128111 ; RRID:Addgene_128111) -
For your References section:
Neurexophilin4 is a selectively expressed alpha-neurexin ligand that modulates specific cerebellar synapses and motor functions. Meng X, McGraw CM, Wang W, Jing J, Yeh SY, Wang L, Lopez J, Brown AM, Lin T, Chen W, Xue M, Sillitoe RV, Jiang X, Zoghbi HY. Elife. 2019 Sep 16;8. pii: 46773. doi: 10.7554/eLife.46773. 10.7554/eLife.46773 PubMed 31524598