pJL1-EPA-DNNNS-DQNRT
(Plasmid
#128397)
-
PurposeIn vitro expression of P. aeruginosa exotoxin A with DNNNS and DQNRT internal glycosylation sites
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1765
- Total vector size (bp) 3664
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExotoxin A
-
SpeciesP. aeruginosa
-
Insert Size (bp)1906
-
Mutation242DNNNS246 and 384DQNRT388 engineered glycosylation sites
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byExotoxin A with internal DNNNS and DQNRT glycosylation sites was originally described by Cuccui, et al. doi.org/10.1098/rsob.130002
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1-EPA-DNNNS-DQNRT was a gift from Michael Jewett (Addgene plasmid # 128397 ; http://n2t.net/addgene:128397 ; RRID:Addgene_128397) -
For your References section:
On-demand biomanufacturing of protective conjugate vaccines. Stark JC, Jaroentomeechai T, Moeller TD, Hershewe JM, Warfel KF, Moricz BS, Martini AM, Dubner RS, Hsu KJ, Stevenson TC, Jones BD, DeLisa MP, Jewett MC. Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb. 10.1126/sciadv.abe9444 PubMed 33536221