pMJA290
(Plasmid
#128542)
-
PurposeExpresses nut lipid binding TCR
-
Depositing Lab
-
Depositing OrganizationUniversity of Nottingham
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1(+)/Zeo(+)
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 4784
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLipid binding Human TCR
-
Alt nameMK764035*
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3029
- Promoter bidirectional CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTGTGAGCCAGGGCATTGG
- 3′ sequencing primer GACAATGCGATGCAATTTCCTCAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lipid binding gamma delta TCR. 5' cloning site Esp31 (not destroyed). 3' cloning site Esp31 (not destroyed).
Addgene NGS found a single nucleotide deletion in the gamma chain, resulting in a frameshift and early termination of the translation, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory has confirmed that this TCR receptor is functional and has been recently successfully used in their lab
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA290 was a gift from Marcos Alcocer (Addgene plasmid # 128542 ; http://n2t.net/addgene:128542 ; RRID:Addgene_128542)