uORF1-Mreinit- 36xMashTag-BFP-3xStop-24xPP7 (uORF-MashTag reporter)
(Plasmid
#128609)
-
PurposeExpresses uORF1 -36xMashTag with MoonTag as readout for reinitiation, followed by BFP linker and 24 repeats of PP7 hairpins in 3’ UTR.
-
Depositing Lab
-
Depositing OrganizationHubrecht Institute
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 128609-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 128609-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA4/TO
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameuORF1-36xMashTag
- Promoter Pcmv
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid has 24 repeats of PP7 hairpins in 3'UTR.
DNA (Catalog # 128609-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 128609-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
uORF1-Mreinit- 36xMashTag-BFP-3xStop-24xPP7 (uORF-MashTag reporter) was a gift from Marvin Tanenbaum (Addgene plasmid # 128609 ; http://n2t.net/addgene:128609 ; RRID:Addgene_128609) -
For your References section:
Multi-Color Single-Molecule Imaging Uncovers Extensive Heterogeneity in mRNA Decoding. Boersma S, Khuperkar D, Verhagen BMP, Sonneveld S, Grimm JB, Lavis LD, Tanenbaum ME. Cell. 2019 Jun 5. pii: S0092-8674(19)30499-4. doi: 10.1016/j.cell.2019.05.001. 10.1016/j.cell.2019.05.001 PubMed 31178119