pBT346.6-H3.3-K4M-bGHpolyA
(Plasmid
#128743)
-
PurposeInducible expression of histone H3.3K4M-FLAG/HA
-
Depositing Lab
-
Depositing OrganizationNational Institute of Diabetes & Digestive & Kidney Diseases (NIDDK)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 128743-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 128743-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBT346.6
-
Backbone manufacturerApplied StemCell
- Backbone size w/o insert (bp) 818
- Total vector size (bp) 7065
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH3.3K4M
-
SpeciesH. sapiens (human)
-
Insert Size (bp)553
-
MutationK4M
-
GenBank IDNM_002107.6
-
Entrez GeneH3-3A (a.k.a. BRYLIB1, H3-3B, H3.3A, H3F3, H3F3A)
- Promoter CAG
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CTTATATAACTTCGTATAATG
- 3′ sequencing primer GTCAGCTTTTTGTACAAACT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 128743-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 128743-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBT346.6-H3.3-K4M-bGHpolyA was a gift from Kai Ge (Addgene plasmid # 128743 ; http://n2t.net/addgene:128743 ; RRID:Addgene_128743) -
For your References section:
H3.3K4M destabilizes enhancer H3K4 methyltransferases MLL3/MLL4 and impairs adipose tissue development. Jang Y, Broun A, Wang C, Park YK, Zhuang L, Lee JE, Froimchuk E, Liu C, Ge K. Nucleic Acids Res. 2019 Jan 25;47(2):607-620. doi: 10.1093/nar/gky982. 10.1093/nar/gky982 PubMed 30335158