Skip to main content

pcDNA3.1(+) eGFP SH3BP5 G4
(Plasmid #129022)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129022 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 129022-D50 50 μg of DNA in Tris buffer $495
DNA 129022-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Life Technologies
  • Total vector size (bp) 6271
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+) eGFP SH3BP5 G4 was a gift from Jeremy Wilusz (Addgene plasmid # 129022 ; http://n2t.net/addgene:129022 ; RRID:Addgene_129022)
  • For your References section:

    An improved method for circular RNA purification using RNase R that efficiently removes linear RNAs containing G-quadruplexes or structured 3' ends. Xiao MS, Wilusz JE. Nucleic Acids Res. 2019 Jul 3. pii: 5527976. doi: 10.1093/nar/gkz576. 10.1093/nar/gkz576 PubMed 31269210