A102 ΔAmpH Δ2x+ve
(Plasmid
#129484)
-
PurposeExpression of Glo3 ΔAmpH lacking the COPI-binding motif in E.Coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePQE
- Total vector size (bp) 7203
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameADP-ribosylation factor GTPase-activating protein
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneGLO3 (a.k.a. YER122C)
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xma1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer tctggtatgccgtgcgtactgcggtgatca
- 3′ sequencing primer GGCAACCGAGCGTTCTGAACAAATCCAGAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A102 ΔAmpH Δ2x+ve was a gift from Blanche Schwappach (Addgene plasmid # 129484 ; http://n2t.net/addgene:129484 ; RRID:Addgene_129484) -
For your References section:
Dissection of GTPase-activating proteins reveals functional asymmetry in the COPI coat of budding yeast. Arakel EC, Huranova M, Estrada AF, Rau EM, Spang A, Schwappach B. J Cell Sci. 2019 Aug 29;132(16). pii: jcs.232124. doi: 10.1242/jcs.232124. 10.1242/jcs.232124 PubMed 31331965