-
PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mEGFP and His-tag. This plasmid is for bacteria protein expression under T7 promoter and protein purification with HisTrap.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepET23b
-
Backbone manufacturerMillipore Sigma
- Backbone size w/o insert (bp) 3666
- Total vector size (bp) 5162
-
Modifications to backboneNo modifications to backbone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-HA frankenbody-mEGFP (15F11-HA scFv-mEGFP)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1574
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET23b-15F11-HA-mEGFP-6xHis was a gift from Tim Stasevich (Addgene plasmid # 129593 ; http://n2t.net/addgene:129593 ; RRID:Addgene_129593) -
For your References section:
A genetically encoded probe for imaging nascent and mature HA-tagged proteins in vivo. Zhao N, Kamijo K, Fox PD, Oda H, Morisaki T, Sato Y, Kimura H, Stasevich TJ. Nat Commun. 2019 Jul 3;10(1):2947. doi: 10.1038/s41467-019-10846-1. 10.1038/s41467-019-10846-1 PubMed 31270320