-
PurposeAAVS1 safe harbor targeting vector expressing AtAFB2-mCherry
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki
Located in Finland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 129716-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 129716-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSH-EFIRES-P
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 10671
-
Vector typeMammalian Expression, CRISPR, TALEN ; Human safe harbor locus (A AVS1) site-specific integration
-
Selectable markersPuromycin ; mCherry for FACS enrichment
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAFB2
-
Alt nameauxin signaling F-box 2
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2445
-
Mutationcodon optimized
-
Entrez GeneAFB2 (a.k.a. AT3G26810, auxin signaling F-box 2)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tctctccacaggtgtccact
- 3′ sequencing primer acaccggccttattccaagc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAtAFB2 codon-optimized and synthesized by Genscript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 129716-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 129716-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH-EFIRES-P-AtAFB2-mCherry was a gift from Elina Ikonen (Addgene plasmid # 129716 ; http://n2t.net/addgene:129716 ; RRID:Addgene_129716) -
For your References section:
An efficient auxin-inducible degron system with low basal degradation in human cells. Li S, Prasanna X, Salo VT, Vattulainen I, Ikonen E. Nat Methods. 2019 Aug 26. pii: 10.1038/s41592-019-0512-x. doi: 10.1038/s41592-019-0512-x. 10.1038/s41592-019-0512-x PubMed 31451765