pTK_BsmBI_LacZ_Citrine_Nanotag_9
(Plasmid
#130516)
-
PurposeEnhancer cloning nanotag reporter vector
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 130516-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 130516-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTK_BsmBI
- Backbone size w/o insert (bp) 4670
-
Vector typeEnhancer cloning nanotag reporter vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLacZ
-
Insert Size (bp)276
- Promoter thymidine kinase minimal promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer pTK forward CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer pTK reverse ATATTTCTTCCGGGGACACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 130516-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 130516-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK_BsmBI_LacZ_Citrine_Nanotag_9 was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 130516 ; http://n2t.net/addgene:130516 ; RRID:Addgene_130516) -
For your References section:
Reconstruction of the Global Neural Crest Gene Regulatory Network In Vivo. Williams RM, Candido-Ferreira I, Repapi E, Gavriouchkina D, Senanayake U, Ling ITC, Telenius J, Taylor S, Hughes J, Sauka-Spengler T. Dev Cell. 2019 Oct 21;51(2):255-276.e7. doi: 10.1016/j.devcel.2019.10.003. 10.1016/j.devcel.2019.10.003 PubMed 31639368