pYJ33-lenti-U6-Oct4-PE-acti-gRNA-DsRed
(Plasmid
#131076)
-
PurposeActivation of Mafa via SAM system
-
Depositing Lab
-
Depositing OrganizationPennsylvania State University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneplenti-MS2-U6-gRNA-DsRed
- Backbone size w/o insert (bp) 15000
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOCT4 proximal enhancer gRNA
-
gRNA/shRNA sequenceAGGGAGAACGGGGCCTACCG
-
SpeciesH. sapiens (human)
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer hUBCpro-F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYJ33-lenti-U6-Oct4-PE-acti-gRNA-DsRed was a gift from Xiaojun Lian (Addgene plasmid # 131076 ; http://n2t.net/addgene:131076 ; RRID:Addgene_131076)