GFP-muSOX
(Plasmid
#131701)
-
Purposeexpresses muSOX with GFP N-terminally fused
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 131701-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 131701-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 6216
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-muSOX
-
Alt namemORF37
-
SpeciesMHV68
-
Insert Size (bp)2205
-
GenBank ID
-
Entrez GeneGAMMAHV.ORF37
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer aaaatttaacgcgaattttaacaaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGlaunsinger Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 131701-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 131701-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-muSOX was a gift from Britt Glaunsinger (Addgene plasmid # 131701 ; http://n2t.net/addgene:131701 ; RRID:Addgene_131701) -
For your References section:
Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. Gilbertson S, Federspiel JD, Hartenian E, Cristea IM, Glaunsinger B. Elife. 2018 Oct 3;7. pii: 37663. doi: 10.7554/eLife.37663. 10.7554/eLife.37663 PubMed 30281021