pMH1105
(Plasmid
#131864)
-
PurposeProduces holo-PhyB-AviTag in E. coli
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDFDuet-1
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePhyB(1-651)-AviTag-His6
-
Alt namePhyB-AviTag
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)2031
- Promoter T7 promoter-1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHO1
-
SpeciesSynechocystis PCC 6803
-
Insert Size (bp)723
- Promoter T7 promoter-2
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePcyA
-
SpeciesSynechocystis PCC 6803
-
Insert Size (bp)747
- Promoter T7 promoter-2
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GGGTTATGCTAGTTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH1105 was a gift from Wilfried Weber (Addgene plasmid # 131864 ; http://n2t.net/addgene:131864 ; RRID:Addgene_131864) -
For your References section:
Production, Purification and Characterization of Recombinant Biotinylated Phytochrome B for Extracellular Optogenetics. Horner M, Yousefi OS, Schamel WWA, Weber W. Bio Protoc. 2020 Mar 5;10(5):e3541. doi: 10.21769/BioProtoc.3541. eCollection 2020 Mar 5. 10.21769/BioProtoc.3541 PubMed 33659515