Skip to main content

pPU-Empty-miR30-TRIM5
(Plasmid #132936)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132936 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pPU-Empty-miR30
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    control shRNA
  • gRNA/shRNA sequence
    TGCCAAGCATGCCTCACTGCAA
  • Species
    H. sapiens (human)
  • Promoter SFFV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer NA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPU-Empty-miR30-TRIM5 was a gift from Jeremy Luban (Addgene plasmid # 132936 ; http://n2t.net/addgene:132936 ; RRID:Addgene_132936)
  • For your References section:

    Cyclophilin A protects HIV-1 from restriction by human TRIM5alpha. Kim K, Dauphin A, Komurlu S, McCauley SM, Yurkovetskiy L, Carbone C, Diehl WE, Strambio-De-Castillia C, Campbell EM, Luban J. Nat Microbiol. 2019 Dec;4(12):2044-2051. doi: 10.1038/s41564-019-0592-5. Epub 2019 Oct 21. 10.1038/s41564-019-0592-5 PubMed 31636416