Skip to main content

BE3-hA3A-R128A
(Plasmid #132944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132944 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 132944-D50 50 μg of DNA in Tris buffer $495
DNA 132944-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    X330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Feng Zhang Lab (Addgene#: 42230)
  • Vector type
    Mammalian Expression, CRISPR ; Base editor

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BE3-hA3A(R128A)
  • gRNA/shRNA sequence
    GGCCCAGACTGAGCACGTGA
  • Species
    Synthetic
  • Insert Size (bp)
    7937
  • Mutation
    BE3-hA3A(R128A)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BE3-hA3A-R128A was a gift from Hui Yang (Addgene plasmid # 132944 ; http://n2t.net/addgene:132944 ; RRID:Addgene_132944)
  • For your References section:

    Off-target RNA mutation induced by DNA base editing and its elimination by mutagenesis. Zhou C, Sun Y, Yan R, Liu Y, Zuo E, Gu C, Han L, Wei Y, Hu X, Zeng R, Li Y, Zhou H, Guo F, Yang H. Nature. 2019 Jul;571(7764):275-278. doi: 10.1038/s41586-019-1314-0. Epub 2019 Jun 10. 10.1038/s41586-019-1314-0 PubMed 31181567