pSHUT4-eYFP
(Plasmid #133094)

• Purpose: Agrobacterium T-DNA overexpression cassette comprising constitutive TEF-1alpha fused to reporter eYFP. Integrates near beta-tubulin gene in F. solani genome. Replace eYFP w/ XhoI BamHI
• Depositing Lab: Jens Laurids Sørensen
• Depositing Organization: Aalborg Universitet
  Located in Denmark
• Publication: Nielsen et al Fungal Biol Biotechnol. 2019 Dec 11;6:25. doi: 10.1186/s40694-019-0089-2. eCollection 2019.

Backbone

• Vector backbone: pSHUT3
• Backbone manufacturer: In-house plasmid
• Total vector size (bp): 10460
• Modifications to backbone: Backbone is U-GOTL modified with URA3 from pYES2(Invitrogen) and CEN-ARS from pRS315 (ATCC 77144)
• Vector type: Fungal expression
• Selectable markers: Gentamicin, URA3

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: enhanced yellow flourescent protein
• Alt name: eYFP
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: TEF-1α

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTTCCCCCATACCTCCTTTC
• 3′ sequencing primer: AAGACCGGCAACAGGATTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Agrobacterium T-DNA cassette taken from p-UGOTL-TEF1α-eYFP (Lukassen et al, Mar Drugs 2015, 13:4331-4343.) holding the eYFP gene from EarleyGate 104 (Earley et al. The Plant Journal 2006, 45(4):616-629.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 133094-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 133094-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.