Skip to main content
Addgene
Open Menu

pNEXdelta-EGFP-ApAF
(Plasmid #13335)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13335 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 13335-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 13335-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pNEXdelta
  • Backbone size w/o insert (bp) 2800

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Aplysia activating factor
  • Species
    A. kurodai
  • Insert Size (bp)
    1830
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ACGCGTCGACGCCACCACCATGATATCCAGCATTTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The order of restriction sites is: HindIII, EGFP (750bp), SalI, ApAF (1080bp), BamHI.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNEXdelta-EGFP-ApAF was a gift from Bong-Kiun Kaang (Addgene plasmid # 13335 ; http://n2t.net/addgene:13335 ; RRID:Addgene_13335)

  • For your References section:

    PKA-activated ApAF-ApC/EBP heterodimer is a key downstream effector of ApCREB and is necessary and sufficient for the consolidation of long-term facilitation. Lee JA, Lee SH, Lee C, Chang DJ, Lee Y, Kim H, Cheang YH, Ko HG, Lee YS, Jun H, Bartsch D, Kandel ER, Kaang BK. J Cell Biol. 2006 Sep 11. 174(6):827-38. 10.1083/jcb.200512066 PubMed 16966424
Related items:
Commonly requested with: