lentiCRISPRv2-Snrnp40
(Plasmid
#134255)
-
PurposeLentivector for Snrnp40 CRISPR knockout
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 52961)
- Backbone size w/o insert (bp) 13000
- Total vector size (bp) 13000
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSnrp40
-
Alt nameWdr57
-
Alt namePrp8bp
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
MutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”
-
GenBank IDNM_025645
-
Entrez GeneSnrnp40 (a.k.a. 0610009C03Rik, Prp8bp, Wdr57)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPRv2-Snrnp40 was a gift from Bruce Beutler (Addgene plasmid # 134255 ; http://n2t.net/addgene:134255 ; RRID:Addgene_134255) -
For your References section:
Syndromic immune disorder caused by a viable hypomorphic allele of spliceosome component Snrnp40. Zhang D, Yue T, Choi JH, Nair-Gill E, Zhong X, Wang KW, Zhan X, Li X, Choi M, Tang M, Quan J, Hildebrand S, Moresco EMY, Beutler B. Nat Immunol. 2019 Oct;20(10):1322-1334. doi: 10.1038/s41590-019-0464-4. Epub 2019 Aug 19. 10.1038/s41590-019-0464-4 PubMed 31427773